Open access

A molecular assessment of infectious agents carried by Atlantic salmon at sea and in three eastern Canadian rivers, including aquaculture escapees and North American and European origin wild stocks

Publication: FACETS
23 April 2020

Abstract

Infectious agents are key components of animal ecology and drivers of host population dynamics. Knowledge of their diversity and transmission in the wild is necessary for the management and conservation of host species like Atlantic salmon (Salmo salar). Although pathogen exchange can occur throughout the salmon life cycle, evidence is lacking to support transmission during population mixing at sea or between farmed and wild salmon due to aquaculture exposure. We tested these hypotheses using a molecular approach that identified infectious agents and transmission potential among sub-adult Atlantic salmon at marine feeding areas and adults in three eastern Canadian rivers with varying aquaculture influence. We used high-throughput qPCR to quantify infection profiles and next generation sequencing to measure genomic variation among viral isolates. We identified 14 agents, including five not yet described as occurring in Eastern Canada. Phylogenetic analysis of piscine orthoreovirus showed homology between isolates from European and North American origin fish at sea, supporting the hypothesis of intercontinental transmission. We found no evidence to support aquaculture influence on wild adult infections, which varied relative to environmental conditions, life stage, and host origin. Our findings identify research opportunities regarding pathogen transmission and biological significance for wild Atlantic salmon populations.

Introduction

Infectious agents such as viruses, bacteria, and other microparasites are ubiquitous in aquatic and marine environments (Marcogliese 2008; Lafferty 2017), yet their diversity among wild fish hosts remains largely undescribed. Logistical constraints of studying pathogens in the wild have limited our understanding of naturally occurring infections in wild fishes (Miller et al. 2014). This knowledge is necessary to anticipate how changing environmental conditions may affect the virulence of endemic agents, the introduction of exotic agents, and associated disease development (Burge et al. 2014), which have the potential to drive host population dynamics and the economics of fisheries (Selakovic et al. 2014; Johnson et al. 2015; Lafferty et al. 2015). Most information on fish disease has been derived from aquaculture settings where fish are more easily observed in later stages of disease (Bakke and Harris 1998). However, extrapolation of this information to wild fishes may be misleading as conditions experienced by cultured fish differ greatly from wild fish. A prime example is the Atlantic salmon (Salmo salar), which is a key cultured species with well-established relationships between infection dynamics and survival in captivity (Bakke and Harris 1998). While farmed salmon are fed, handled, and held at high densities, wild salmon must hunt for prey, avoid predators, migrate across dynamic environments, and are generally found at relatively lower densities throughout most of their life history. These differences likely contribute to disparate disease outcomes between wild and cultured salmon, even for the same pathogen. To inform future research on how pathogens may influence host population dynamics, evaluations are needed that characterize infectious agents carried by wild and cultured Atlantic salmon.
Since the late 1980s, Atlantic salmon populations have experienced large declines in abundance over much of their range (Parrish et al. 1998; Klemetsen et al. 2003). Wild Atlantic salmon begin their lives in fresh water, rear in natal rivers for one to seven years, and then migrate to marine feeding areas in the North Atlantic Ocean; at maturity, adults return to natal rivers to spawn and then can migrate back out to sea (Jonsson and Jonsson 2011). Survival throughout marine migrations has been shown to be a key factor in observed population declines, yet these life stages remain relatively understudied and the causes of mortality unknown (Hansen and Quinn 1998; Sheehan et al. 2012). Pathogen transmission dynamics in marine habitats and how infections contribute to wild salmon mortality at sea is even less well known (Hansen and Quinn 1998). Substantial mixing of stocks occurs in the Labrador Sea near Greenland (Chaput et al. 2018), including both North American and European origin fish (Reddin and Friedland 1999; Sheehan et al. 2012). This mixing not only provides an opportunity for infectious agents to spread among individuals, but also geographical areas since salmon will eventually migrate back to natal freshwater systems to spawn (Madhun et al. 2018; Vendramin et al. 2019). Introduction of emerging pathogens or pathogen strains through intercontinental exchange may pose new risks to otherwise threatened populations in a way that is not easily controlled by anthropogenic activities. Although the transmission of agents may or may not result in disease or reduced host survival, understanding if and where pathogen exchange occurs is a crucial first step toward characterizing impacts on wild Atlantic salmon across their range, including the influence of human activities like aquaculture.
Many wild Atlantic salmon stocks come into contact with aquaculture facilities during seaward or spawning migrations, which may result in infectious agent exchange between farmed and wild fish (Heggberget et al. 1993; Garseth et al. 2018). There is also a persistent issue of escapees from salmon farms mixing with wild stocks, posing further opportunities for pathogen transmission in addition to potential interbreeding and fitness consequences for wild salmon (Castellani et al. 2018). Modeling studies of wild Pacific salmon (Oncorhynchus spp.) on the west coast of Canada have demonstrated decreased wild salmon productivity in association with exposure to Atlantic salmon farms with high macroparasite (sea lice) densities (Krkošek et al. 2011; Peacock et al. 2013). Microparasites such as viruses, bacteria, and various metazoan species certainly have the potential to impact wild salmon productivity, especially under poor environmental conditions (Burge et al. 2014).
Despite recent advances in our understanding of the diversity of infectious agents hosted by salmon on Canada’s west coast (Bass et al. 2017; Di Cicco et al. 2017, 2018; Nekouei et al. 2018; Tucker et al. 2018), our knowledge of infectious agents affecting wild Atlantic salmon on the east coast remains scant. Infectious agent surveys can be used to direct future research toward quantifying specific host interactions; for example, similarities in the composition of agent species and genotypes hosted by wild and cultured Atlantic salmon may indicate farm–wild pathogen exchange (Olivier 2002; Johansen et al. 2011). Importantly, coinfection (multiple agent species in one host) and superinfection (multiple agent genotypes in one host) are common in wild animals and the dynamics of these communities are linked to host fitness outcomes (Martin et al. 2012; Alizon et al. 2013; Sofonea et al. 2015). Host health and performance, especially in the wild, can be impacted by shifts in coinfection or superinfection prior to the occurrence of detectable or typical tissue changes (pathology) associated with disease (Brassard et al. 1982; Wiik-Nielsen et al. 2016; Downes et al. 2018). This complexity warrants an approach beyond traditional diagnostics to characterize transmission events that can influence disease processes in wild fish.
Molecular tools are rapidly increasing our ability to describe the pathogen dynamics of wild animal populations and can be cost-effectively applied to quantify an array of infectious agents (e.g., Miller et al. 2016). The minimal tissue requirements of molecular approaches allow for nonlethal tissue biopsy, which is especially useful for studying populations of conservation concern (Archie et al. 2009). Studies of wild Pacific salmon in British Columbia, Canada, have successfully applied high-throughput polymerase chain reaction (HT-qPCR) for infectious agent screening and host response characterization (Jeffries et al. 2014; Miller et al. 2014; Bass et al. 2017). As this HT-qPCR tool was developed to include assays to pathogens impacting salmon worldwide, the same approach is amenable to application in Atlantic salmon on the east coast of Canada. Additional molecular techniques, such as next generation sequencing (NGS), can provide further insight into how and where pathogens are exchanged in the wild; for example, hosts that carry phylogenetically similar viral strains likely share a transmission source and (or) location (Stimson et al. 2019). RNA viruses are especially useful for characterizing pathogen transmission dynamics due to their relatively high strain variability across spatial and temporal gradients (Stimson et al. 2019). By combining qPCR and sequencing approaches, we can not only quantify similarity in coinfection profiles based on location (marine sub-adults and freshwater adults) and source (wild and cultured escapees), but also conduct phylogenetic analysis of viruses to identify evidence of transmission at sea or between farmed and wild fish.
We tested two hypotheses using a molecular approach: (H1) the Labrador Sea will comprise a melting pot of European and North American origin salmon as a potential area where pathogen exchange between fish of different continents occurs, and (H2) adult salmon exchange infectious agents with cultured salmon during spawning migration, resulting in similarity in infection profiles based on the proximity of their natal rivers to aquaculture. Atlantic salmon were collected from marine feeding grounds near Greenland (sub-adults) and from three eastern Canadian rivers (mature adults) with variable aquaculture influences: distant from aquaculture (Restigouche River, nonthreatened wild population), proximal to aquaculture (St. John River, threatened wild population), and aquaculture escapees (Magaguadavic River, where resident wild population is extirpated). Tissue samples were evaluated for the presence and loads of 44 viruses, bacteria, and other microparasites known or expected to cause disease in salmon worldwide using a high-throughput Fluidigm BioMark platform (Fluidigm Corporation, San Francisco, CA, USA) and assay panel (Miller et al. 2014, 2016). To identify potential natural (marine stock mixing) and anthropogenic (aquaculture-wild) transmission routes, we compared viral isolates from this study with published sequences obtained from Atlantic salmon in previous studies worldwide. Our objective was to provide baseline data to inform future studies of the transmission and disease dynamics of wild Atlantic salmon.

Methods

Sample collection, preservation, and transfer

Biological sampling at all fish collection sites included a fork-length measurement, external morphology assessment, scale and tissue sampling, and external observation for macroparasites. Tissues were sampled from fish (∼0.5 mg) using sterile tools and fixed in RNAlater (Ambion, Austin, Texas, USA; 1.5 mL). Gill, heart, and kidney biopsy samples (multi-tissue) were taken from fish in Greenland and at the Magaguadavic and Restigouche rivers in 2017, whereas only kidney samples were taken from Greenland-sampled fish in 2016 and only nonlethal gill biopsies from fish of the threatened St. John River population in 2017. Gill biopsies have been shown to comprise most infectious agents detected in multi-tissue HT-qPCR analyses (Teffer and Miller, 2019).
To obtain samples from offshore marine waters where fish from North American and European stocks mix, wild salmon were collected over two years by commercial fishers using gill nets in the Labrador Sea along the coast of Greenland (Fig. 1). Direct acquisition of freshly landed fish and tissue sampling took place at local markets in Paamiut and Maniitsoq, Greenland, in September of 2016 (N = 43; kidney only, Paamiut) and 2017 (N = 30; multi-tissue, Maniitsoq), respectively. Tissues collected in Greenland in 2016 were stored at 4 °C for 30 d and then −20 °C for 13 months. Tissues collected in Greenland in 2017 were stored at 4 °C for 24 h and then −20 °C for 2 months. Greenland-collected samples were transported from Greenland to Quebec, Canada, on ice (stored at −20 °C at night during 3 d transport), and then shipped on dry ice to the Atlantic Salmon Federation (ASF) headquarters in Chamcook, New Brunswick, Canada, where they were stored at −80 °C until analysis.
Fig. 1.
Fig. 1. Map of study area. Fish collection sites included three eastern Canadian rivers (Restigouche (black), St. John (red), and Magaguadavic (light blue) in New Brunswick (NB)) and offshore fishing areas located in the Labrador Sea, with fish obtained from commercial fishers at local markets in Maniitsoq (green) and Paamiut (dark blue), Greenland (marine fishing took place in offshore waters of Labrador Sea). Map assembled using the “sp” R package and RData from the GADM database of Global Administrative Areas, version 2.0.
Salmon bearing rivers were sampled in 2017, including the Restigouche (low aquaculture influence; N = 30), St. John (high aquaculture influence; N = 30), and Magaguadavic rivers (aquaculture escapees; N = 17; Table 1, Fig. 1). The Restigouche River sampling site is isolated from aquaculture influence and located near the head of tide. Restigouche fish were lethally sampled between 12 June and 1 July 2017 with the collaboration of Listuguj Mi’gmaq fishers following chain of custody procedures for sample preservation (see below). Restigouche tissue samples were stored at 4 °C for 24 h and then at −18 °C for ≤18 d, then transported on ice to the ASF headquarters in Chamcook, New Brunswick, (≤24 h transport) and stored at −80 °C.
Table 1.
Table 1. Adult salmon sampled for infectious agent screening using high-throughput qPCR.
Source locationContinent of originYearTissue type(s)NFork length, mm (mean ± SD)
Labrador Sea near GreenlandNorth America2016Kidney10654 ± 24
  2017Multi-tissuea26672 ± 55
 European2016Kidney33618 ± 25
  2017Multi-tissuea4668 ± 20
Restigouche RiverNorth America2017Multi-tissuea30836 ± 67
St. John RiverNorth America2017Gill30572 ± 31
Magaguadavic RiverNorth America2017Multi-tissuea17653 ± 47
a
Gill, heart, and kidney.
In the St. John River, returning adult wild and hatchery (released at the juvenile stage) Atlantic salmon were sampled nonlethally for gill tissue at the Department of Fisheries and Oceans (DFO) Biodiversity Facility near the base of Mactaquac Dam situated 3 km above head of tide; this facility is approximately 100 km upstream from the river mouth and is proximal to the commercial salmon aquaculture industry. The St. John tissue samples were transported to the ASF headquarters on ice (≤2 h transport), stored at 4 °C for 24 h, and then stored at −80 °C.
The Magaguadavic River collection site is proximal to commercial Atlantic salmon aquaculture operations in the Bay of Fundy, and escaped salmon are a regular occurrence in the river (Carr 1995; Morris et al. 2008). Escapees were collected from a trap in a head of tide fish ladder, identified as escapees using external morphology and scale characteristics (Carr 1995), euthanized, and then transported on ice to ASF headquarters (20 min) for tissue sampling. Tissue samples were stored at ASF headquarters at 4 °C for 24 h and then stored at −80 °C.
Tissue samples from all locations were stored at the ASF headquarters in a −80 °C freezer for 50–255 d. All samples were shipped on dry ice to the DFO Pacific Biological Station, Nanaimo, British Columbia, on 1 February 2018 (1 d transport) and stored at −80 °C until analysis.

Laboratory protocols

Greenland fish were genotyped using genome-wide single-nucleotide polymorphisms (Jeffery et al. 2018) at the DFO Salmonids Section Population Genomic Lab to assign North American or European origin (Table 1). Infection profiles were evaluated at the DFO Molecular Genetics Laboratory, Pacific Biological Station, using the Fluidigm BioMark HT-qPCR platform and assay panel to quantify the presence and relative loads of 44 infectious agents in RNA extracted from preserved tissues (Table 2). Most assays included in the panel for this study have been analytically validated for specificity, sensitivity, repeatability, and reproducibility between platforms (Miller et al. 2016), with the exception of Atlantic salmon calicivirus (ASCV) and salmon gill poxvirus (SGPV), which were added after the initial panel was developed and validated (only specificity and sensitivity validated). Tissue preparation, nucleic acid extraction and normalization, cDNA synthesis, specific target amplification, incorporation of artificial control standards and processing controls, and dynamic array preparations were completed according to protocols described by Miller et al. (2016). The primers and probes used in this screening are listed in Table 2. Artificial positive controls (Chinook embryo cell control nucleic acids, infectious agent artificial control standards) and negative controls were included in the protocol and a second fluorescent NED-labeled dye (Applied Biosystems, Foster City, CA, USA) was included in all reaction chambers to detect laboratory contamination by artificial control standards. All singleplex HT-qPCR assays were run in duplicate on dynamic arrays. Limits of detection (LOD) specific to each assay (Miller et al. 2016; Table 2) were applied to the data at 95% detection confidence, which provides a measure of analytical sensitivity corresponding to the amount of analyte in a sample that is expected to produce a positive result 95% of the time. To be incorporated into the analysis, infectious agents needed to be detected in both duplicates at a quantification cycle (Cq) within the 95% LOD. HT-qPCR results are reported as copy number calculated using sample Cq (average of duplicates) and standard curves for each assay. We characterized infections as emerging versus endemic from a review of peer-reviewed and publicly available grey literature (e.g., government and organization reports); we classified the designation “emerging” for agents not previously known to occur in eastern Canada, recognizing that some may be endemic but simply not previously assessed. Throughout, we were careful not to assume the detection of an infectious agent was equivalent to the detection of disease.
Table 2.
Table 2. Assays included in the high-throughput qPCR panel tested on wild and cultures Atlantic salmon tissues.
AgentTypeAbbreviationLimits of detectionPrimer and probe sequencesAccession no.Assay reference
Atlantic salmon calicivirusa
Virusascv27.14
F: ACCGACTGCCCGGTTGT
R: CTCCGATTGCCTGTGATAATACC
P: CTTAGGGTTAAAGCAGTCG
Gideon Mordecai
Infectious hematopoietic necrosis virus
Virusihnv27.64
F: AGAGCCAAGGCACTGTGCG
R: TTCTTTGCGGCTTGGTTGA
P: TGAGACTGAGCGGGACA
NC_001652
Infectious pancreatic necrosis virus
Virusipnv27.63
F: GCAACTTACTTGAGATCCATTATGCT
R: GAGACCTCTAAGTTGTATGACGAGGTCTCT
P: CGAGAATGGGCCAGCAAGCA
Infectious salmon anemia virus
Virusisav26.12
F: TGGGCAATGGTGTATGGTATGA
R: GAAGTCGATGAACTGCAGCGA
P: CAGGATGCAGATGTATGC
EU118822
Salmonid herpesvirus
Virusomv26.59
F: GCCTGGACCACAATCTCAATG
R: CGAGACAGTGTGGCAAGACAAC
P: CCAACAGGATGGTCATTA
Piscine myocarditis virus
Viruspmcv26.29
F: AGGGAACAGGAGGAAGCAGAA
R: CGTAATCCGACATCATTTTGTGA
P: TGGTGGAGCGTTCAA
HQ339954
Piscine reovirus
Virusprv26.11
F: TGCTAACACTCCAGGAGTCATTG
R: TGAATCCGCTGCAGATGAGTA
P: CGCCGGTAGCTCT
Salmon alphavirus
Virussav26.28
F: CCGGCCCTGAACCAGTT
R: GTAGCCAAGTGGGAGAAAGCT
P: TCGAAGTGGTGGCCAG
AY604235
Salmonid gill poxvirus
Virussgpv25.15
F: ATCCAAAATACGGAACATAAGCAAT
R: CAACGACAAGGAGATCAACGC
P: CTCAGAAACTTCAAAGGA
Putative Totiviridae
Virustoti25.87
F: TCTGCGCGCTGCACCTA
R: ATGCGGAGGAACTCACACACT
P: CAAGTGCTACACTGCG
Gideon Mordecai
Viral erythrocytic necrosis virus
Virusven24.85
F: CGTAGGGCCCCAATAGTTTCT
R: GGAGGAAATGCAGACAAGATTTG
P: TCTTGCCGTTATTTCCAGCACCCG
Viral encephalopathy and retinopathy virus
Virusvenv26.21
F: TTCCAGCGATACGCTGTTGA
R: CACCGCCCGTGTTTGC
P: AAATTCAGCCAATGTGCCCC
AJ245641
Viral hemorrhagic septicemia virus
Virusvhsv26.86
F: AAACTCGCAGGATGTGTGCGTCC
R: TCTGCGATCTCAGTCAGGATGAA
P: TAGAGGGCCTTGGTGATCTTCTG
Z93412
Aeromonas hydrophila
Bacteriumae_hy28.67
F: ACCGCTGCTCATTACTCTGATG
R: CCAACCCAGACGGGAAGAA
P: TGATGGTGAGCTGGTTG
AY165026
Aeromonas salmonicida
Bacteriumae_sal25.61
F: TAAAGCACTGTCTGTTACC
R: GCTACTTCACCCTGATTGG
P: ACATCAGCAGGCTTCAGAGTCACTG
M64655
Flavobacterium psychrophilum
Bacteriumfl_psy29.46
F: GATCCTTATTCTCACAGTACCGTCAA
R: TGTAAACTGCTTTTGCACAGGAA
P: AAACACTCGGTCGTGACC
Ca. Piscichlamydia salmonisa
Bacteriumpch_sal30.72
F: TCACCCCCAGGCTGCTT
R: GAATTCCATTTCCCCCTCTTG
P: CAAAACTGCTAGACTAGAGT
EU326495
Piscirickettsia salmonis
Bacteriumpisck_sal23.32
F: TCTGGGAAGTGTGGCGATAGA
R: TCCCGACCTACTCTTGTTTCATC
P: TGATAGCCCCGTACACGAAACGGCATA
U36943
Renibacterium salmoninarum
Bacteriumre_sal25.91
F: CAACAGGGTGGTTATTCTGCTTTC
R: CTATAAGAGCCACCAGCTGCAA
P: CTCCAGCGCCGCAGGAGGAC
AF123890
Rickettsia-like organism
Bacteriumrlo25.23
F: GGCTCAACCCAAGAACTGCTT
R: GTGCAACAGCGTCAGTGACT
P: CCCAGATAACCGCCTTCGCCTCCG
EU555284
Ca. Syngnamydia salmonisa
Bacteriumsch27.9
F: GGGTAGCCCGATATCTTCAAAGT
R: CCCATGAGCCGCTCTCTCT
P: TCCTTCGGGACCTTAC
FJ897519
Tenacibaculum maritimum
Bacteriumte_mar26.71
F: TGCCTTCTACAGAGGGATAGCC
R: CTATCGTTGCCATGGTAAGCCG
P: CACTTTGGAATGGCATCG
Vibrio anguillarum
Bacteriumvi_ang26.41
F: CCGTCATGCTATCTAGAGATGTATTTGA
R: CCATACGCAGCCAAAAATCA
P: TCATTTCGACGAGCGTCTTGTTCAGC
L08012
Aliivibrio salmonicida
Bacteriumvi_sal25.84
F: GTGTGATGACCGTTCCATATTT
R: GCTATTGTCATCACTCTGTTTCTT
P: TCGCTTCATGTTGTGTAATTAGGAGCGA
AF452135
Yersinia ruckeri
Bacteriumye_ruc28.13
F: TCCAGCACCAAATACGAAGG
R: ACATGGCAGAACGCAGAT
P: AAGGCGGTTACTTCCCGGTTCCC
Paramoeba perurans
Amoebane_per25.39
F: GTTCTTTCGGGAGCTGGGAG
R: GAACTATCGCCGGCACAAAAG
P: CAATGCCATTCTTTTCGGA
EF216905
Ichthyophthirius multifiliis
Ciliateic_mul23.7
F: AAATGGGCATACGTTTGCAAA
R: AACCTGCCTGAAACACTCTAATTTTT
P: ACTCGGCCTTCACTGGTTCGACTTGG
IMU17354
Gyrodactylus salaris
Flukegy_sal26.42
F: CGATCGTCACTCGGAATCG
R: GGTGGCGCACCTATTCTACA
P: TCTTATTAACCAGTTCTGC
Spironucleus salmonicida
Flagellatesp_sal26.05
F: GCAGCCGCGGTAATTCC
R: CGAACTTTTTAACTGCAGCAACA
P: ACACGGAGAGTATTCT
AY677182
Nanophyetus salmincola
Flukena_sal24.3
F: CGATCTGCATTTGGTTCTGTAACA
R: CCAACGCCACAATGATAGCTATAC
P: TGAGGCGTGTTTTATG
AY269674
Sphaerothecum destruens
Mesomycetozoeasp_des26.5
F: GGGTATCCTTCCTCTCGAAATTG
R: CCCAAACTCGACGCACACT
P: CGTGTGCGCTTAAT
AY267346
Facilispora margolisi
Microsporidianfa_mar30.55
F: AGGAAGGAGCACGCAAGAAC
R: CGCGTGCAGCCCAGTAC
P: TCAGTGATGCCCTCAGA
HM800849
Loma salmonae
Microsporidianlo_sal25.42
F: GGAGTCGCAGCGAAGATAGC
R: CTTTTCCTCCCTTTACTCATATGCTT
P: TGCCTGAAATCACGAGAGTGAGACTACCC
HM626243
Paranucleospora theridiona
Microsporidianpa_ther28.16
F: CGGACAGGGAGCATGGTATAG
R: GGTCCAGGTTGGGTCTTGAG
P: TTGGCGAAGAATGAAA
FJ59481
Ceratonova shasta
Myxozoance_sha28.5
F: CCAGCTTGAGATTAGCTCGGTAA
R: CCCCGGAACCCGAAAG
P: CGAGCCAAGTTGGTCTCTCCGTGAAAAC
AF001579
Myxobolus arcticus
Myxozoanmy_arc26.8
F: TGGTAGATACTGAATATCCGGGTTT
R: AACTGCGCGGTCAAAGTTG
P: CGTTGATTGTGAGGTTGG
HQ113227
Myxobolus insidiosus
Myxozoanmy_ins26.43
F: CCAATTTGGGAGCGTCAAA
R: CGATCGGCAAAGTTATCTAGATTCA
P: CTCTCAAGGCATTTAT
EU346375
Parvicapsula kabatai
Myxozoanpa_kab25.58
F: CGACCATCTGCACGGTACTG
R: ACACCACAACTCTGCCTTCCA
P: CTTCGGGTAGGTCCGG
DQ515821
Parvicapsula minibicornis
Myxozoanpa_min29.62
F: AATAGTTGTTTGTCGTGCACTCTGT
R: CCGATAGGCTATCCAGTACCTAGTAAG
P: TGTCCACCTAGTAAGGC
AF201375
Parvicapsula pseudobranchicolaa
Myxozoanpa_pse25.16
F: CAGCTCCAGTAGTGTATTTCA
R: TTGAGCACTCTGCTTTATTCAA
P: CGTATTGCTGTCTTTGACATGCAGT
AY308481
Tetracapsuloides bryosalmonae
Myxozoante_bry24.98
F: GCGAGATTTGTTGCATTTAAAAAG
R: GCACATGCAGTGTCCAATCG
P: CAAAATTGTGGAACCGTCCGACTACGA
AF190669
Trypanoplasma salmositica
Protozoancr_sal24.34
F: TCAGTGCCTTTCAGGACATC
R: GAGGCATCCACTCCAATAGAC
P: AGGAGGACATGGCAGCCTTTGTAT
Dermocystidium salmonis
Protozoande_sal25.49
F: CAGCCAATCCTTTCGCTTCT
R: GACGGACGCACACCACAGT
P: AAGCGGCGTGTGCC
U21337
Ichthyophonus hoferi
Protozoanic_hof24.17
F: GTCTGTACTGGTACGGCAGTTTC
R: TCCCGAACTCAGTAGACACTCAA
P: TAAGAGCACCCACTGCCTTCGAGAAGA
AF467793
Si:dkey-78d16.1 protein
Host referencehkg45
F: GTCAAGACTGGAGGCTCAGAG
R: GATCAAGCCCCAGAAGTGTTTG
P: AAGGTGATTCCCTCGCCGTCCGA
a
Agents that have not been previously described as occurring in this region in peer-reviewed or publicly available grey literature.

Note: F, forward primer; R, reverse primer, P, probe

Sequencing

A subset of Atlantic salmon samples in which piscine orthoreovirus (PRV-1) or infectious salmon anemia virus (ISAV) were detected were selected for sequence analysis using NGS to validate HT-qPCR detections and conduct phylogenetic analyses. All PRV detections described in this study refer to the PRV-1 genotype. Two North American origin Atlantic salmon collected in offshore waters near Greenland in 2017 were positive for ISAV, but only one had sufficient sequencing coverage for analysis. Three Atlantic salmon samples in which PRV-1 was detected were sequenced: one North American origin, marine-collected fish sampled at the Maniitsoq market, Greenland, in 2017 (J3575_NAM, multi-tissue, PRV-1 Ct of 12.4); one European origin fish sampled at the Paamiut market, Greenland, in 2016 (J3611_EUR, kidney only; PRV-1 Ct of 13.3); and one aquaculture escapee collected in the Magaguadavic River (J3542_MAG, multi-tissue; PRV-1 Ct of 19.1). PRV-1 was chosen as an ideal candidate to evaluate transmission potential at sea and between wild and farmed Atlantic salmon as it has widespread prevalence across the range of Atlantic salmon (and beyond) and was detected in both European and North American origin fish at sea and in aquaculture escapees in this study. To our knowledge, this is the first publication of the full genome sequence for PRV obtained from hosts collected in eastern Canada.
All NGS samples were processed on the same v2 300 Illumina MiSeq sequencing run PRV-1. Samples (J3575_NAM, J3611_EUR, and J3542_MAG) generated ∼2.9, 3.0, and 2.4 mol/L post-trim reads, respectively, with average quality scores of 35.0 or greater. We applied target enrichment for all known viral genomes that infect salmon via the SureSelectXT RNA Direct NGS target workflow (Agilent, Santa Clara, California, USA). A custom set of RNA target enrichment probes (120 base pairs (bp) in length and staggered along the exome or viral RNA) were designed to the genomes of salmonid, relevant fish, and other emerging viruses that were included in our infectious agent HT-qPCR screening platform. These sequences (435.384 kbp) and subsequent bait oligonucleotides included the PRV-1 and ISAV genomes. In the case of ISAV, multiple sequences were included for some segments to represent the various genogroups, hyper polymorphic region (HPR0), and sequences that were <85% homologous. Baits that failed the SureSelect quality assurance or quality control parameters and (or) significantly matched salmonid genes via blast searches were removed, leaving the final set of enrichment probes at 15 609.
We prepared the RNAseq library with the SureSelect Strand-Specific RNA library Prep kit (Agilent, Santa Clara, California, USA) according to manufacturer’s instructions. The adaptor-ligated samples were purified with the Agencourt AMPure XP system (Beckman Coulter, Brea, California, USA). High sensitivity (HS) DNA chips were run on the Agilent 2100 Bioanalyzer (Agilent, Santa Clara, California, USA) to determine the final library size and the Qubit dsDNA HS kit (Invitrogen, Carlsbad, California, USA) was used to determine the concentration. Hybridization of the adapted cDNA library with the viral SureSelect bait capture library (Agilent, Santa Clara, California, USA) was performed at 65°C for 24 h according to manufacturer’s instructions. The cDNA library or capture library hybrids were captured on streptavidin magnetic beads and purified with the Agencourt AMPure XP system (Beckman Coulter, Brea, California, USA). Index tags were added to the postcaptured libraries through 14 rounds of amplification and purified using the Agencourt AMPure XP system (Beckman Coulter, Brea, California, USA). HS DNA chips were run on the Agilent 2100 Bioanalyzer (Agilent, Santa Clara, California, USA) to determine the final library size, and the concentration was determined using the Qubit dsDNA HS kit (Invitrogen, Carlsbad, California, USA). Sample libraries were normalized to 4 nmol/L and denatured and diluted to obtain a final library of 20 pmol/L. The Atlantic salmon enriched RNAseq libraries were processed on one paired end v2 300 bp kit on the Illumina MiSeq System (Illumina, San Diego, California, USA), which included a 10% PhiX Control v3 Library spike-in to improve overall run quality.
Sequence analysis was performed using the Partek Flow software (Partek Inc., St. Louis, Missouri, USA). Adaptors and bases with Phred quality scores <30 were trimmed from both ends and reads less than 25 bp were removed. The remaining reads were aligned to the PRV genome segments of the Norwegian isolate Salmo/GP-2010/NOR (Palacios et al. 2010) using the BWA-MEM (Burrows Wheeler Aligner) software and algorithm with default parameters (Li 2013). SAMtools variant caller was utilized to determine SNPs using the default settings (Li et al. 2009; Li 2011). The consensus sequences were compared against all available sequences in GenBank (Benson et al. 2003) using the BLAST program (blast.ncbi.nlm.nih.gov/Blast.cgi) via the National Center for Biotechnology Information (Altschul et al. 1990) to identify their closest matches across each segment.
ISAV sequences were de novo assembled to enable unbiased assembly of a deletion which is known to occur on segment 6 of the genome that has been associated with virulence (Gagné and LeBlanc 2018). Adapters were removed using Trimmomatic and host-associated reads were removed by alignment to the Atlantic salmon genome using the Burrows–Wheeler aligner (Davidson et al. 2010; Li and Durbin 2010; Bolger et al. 2014). Unmapped sequences were de novo assembled using SPAdes (Bankevich et al. 2012). The viral genomic sequences were aligned using MUSCLE (within Geneious) (Edgar 2004), and an approximately maximum-likelihood phylogenetic tree were constructed using FastTree (Price et al. 2010). The trees were displayed and annotated using Figtree (available at tree.bio.ed.ac.uk/software/figtree/) and ggtree (Yu et al. 2018). PRV and ISAV segment consensus sequences for all sequenced samples were deposited into GenBank under the accession number series MN106286 to MN106316.

Statistical methodology

To quantify and visualize differences in infectious agent communities based on host group membership (Restigouche, St. John, Magaguadavic, Greenland-collected North American origin, and Greenland-collected European origin), we used nonmetric multidimensional scaling (NMDS) analysis and permutational multivariate analysis of variance (PERMANOVA; Fig. 2). Infectious agent loads were normalized to the maximum copy number for each agent (i.e., the quotient of each load value and the maximum load value of that agent in the study) prior to NMDS and PERMANOVA analysis. Any agent detected in fewer than two individuals was removed from the analysis as well as any host with no agents detected to reduce statistical bias (N = 120 fish included in NMDS). Community composition was also visually represented by comparing how agent prevalence and community composition differed among groups; this was achieved by plotting the prevalence of each agent as a proportion of the cumulative prevalence (i.e., the sum of the proportional prevalence of all agents; Fig. 3).
Fig. 2.
Fig. 2. A nonmetric multidimensional scaling (NMDS) analysis of infectious agent profiles determined using HT-qPCR of Atlantic salmon tissues. Adult Atlantic salmon were collected in offshore waters near Greenland (European or North American origin) and three New Brunswick rivers, comprising two wild populations (Restigouche, St. John) and aquaculture escapees (in the Magaguadavic River). Points correspond to individual fish, which are plotted according to load gradients of multiple infectious agents. Abbreviations are defined in Table 2.
Fig. 3.
Fig. 3. Proportional prevalence of infectious agents determined using high-throughput qPCR of Atlantic salmon tissues from fish in marine (Greenland: European (EUR) origin and Greenland: North American (NA) origin) and riverine (Magaguadavic, Restigouche, and St. John rivers, New Brunswick, Canada) environments. Proportional prevalence is defined here as the prevalence of each infectious agent divided by the sum of prevalence values for all agents detected in each host group.
As a cumulative infection metric, relative infection burden (RIB) was calculated for each fish as a composite score incorporating aspects of pathogen richness and loads:
RIB=immLiLmaxi
(1)
where for a given fish, the copy number of the ith infectious agent (Li) is divided by the maximum copy number within the population for the ith infectious agent (Lmaxi) and then summed across all agents (m) detected in the given fish (Bass et al. 2019). We used RIB as a community-level metric of cumulative infection burden, which comprises load, prevalence, and richness information when averaged across a host group to determine if fish sampled in the Labrador Sea in different years (2016 and 2017) could be pooled within continental stock assignment (North American or European origin). Linear regression was used to compare infection profiles between years within stock groups (i.e., identify any significant effect of sampling year within stock groups). Because of the right-skewed distribution of RIB, this variable was log-transformed to meet the assumptions of normality. Generalized linear models (GLM) were used to identify differences in infectious agent richness among groups (total unique agents per host). Where sample sizes allowed (≥10 detections in each group), analysis of variance was used to identify load differences between groups.

Results

Genotyping of marine-collected Atlantic salmon and annual infection differences

Among fish captured in the Labrador Sea near Greenland (marine-collected; Fig. 1), both European and North American stocks were represented in 2016 (kidney tissue only; European origin: N = 33, North American origin: N = 10) and 2017 (multi-tissue; European origin: N = 4, North American origin: N = 26). RIB did not differ significantly between years within continental stock groupings (p > 0.05 for both stock groups), so data from 2016 to 2017 were pooled within stock groups for subsequent analyses and reporting. Year-specific data for marine-collected fish can be found in Table S1.

Prevalence and load differences among collection locations and strains

Fourteen infectious agents were detected overall (both marine and freshwater samples), including four species of bacteria, five viruses, and five other microparasite species, commonly occurring as multiple infections within hosts (Table 3; Figs. 2, 3). PERMANOVA identified a significant effect of group (i.e., collection location and continental origin) on infection profiles (r2 = 0.35, p < 0.01). Three NMDS axes sufficiently comprised variation in infection community profiles (stress = 0.07), with the majority of group separation comprised by the first two axes (Fig. 2). River-collected wild fish (Restigouche, St. John) showed the highest degree of overlap in NMDS positioning and the largest 95% confidence interval areas, suggesting high individual variability in infection profiles of freshwater-collected wild adults relative to other groups. Greenland-collected North American and European origin fish had similar NMDS positioning, though European origin fish loaded higher on axis 1 (furthest from river-collected wild fish). The escapee group was isolated from other groups on the NMDS plot, largely due to strong viral agent influences on infection profiles.
Table 3.
Table 3. Infectious agents detected using high-throughput qPCR of tissues (gill, kidney, or a pool of heart, gill, and kidney) from adult Atlantic salmon captured in the Labrador Sea near Greenland (marine) and in three rivers in eastern Canada.
 Marine: N. American origin (N = 36)Marine: European origin (N = 37)Magaguadavic River (N = 17)Restigouche River (N = 30)St. John River (N = 30)Total
AgentNMeanSDNMeanSDNMeanSDNMeanSDNMeanSDN
Parasites
P. pseudobranchicola
21646315 914453838471927271614167439243108783749
T. bryosalmonae1231 54771 33118351 773656 993571 39599 2150035
P. theridion12339559687369751951181102807636743527617134
I. hoferi238548200151 608 9483 587 30510338 474433 83927
S. destruens1148500001
Bacteria
Ca. P. salmonis383 350130 4822248 725194 1669148 466255 231111 989 4794 397 9909109 302221 32534
F. psychrophilum0001136145175192284442630
A. salmonicida00072 805 6117 186 6803139 877241 67710
Ca. S. salmonis0004855304
Viruses
PRV259808363118 7991324330016
ASCV0010188 248383 841110011
ISAV221826400002
SGPV00222781002
VERV12200001
Richness1.61.10.90.92.81.32.41.3 1.61.3
RIB0.230.50.140.30.210.340.360.4 0.120.23

Note: Total positive detections (N) and the mean and standard deviation (SD) of agent copy numbers, richness (total unique agents per host), and relative infection burden (RIB) are shown for each agent relative to the sampling location. RIB is a composite metric that incorporates richness and load information from all agents detected in each host; PRV, piscine orthoreovirus; ASCV, Atlantic salmon calicivirus; ISAV, infectious salmon anemia virus; SGPV, salmonid gill poxvirus; VERV, encephalopathy and retinopathy virus.

Among marine-collected adult Atlantic salmon, nine infectious agent species were detected, with greater richness among the North American origin group (nine agents; mean 1.6 agents per individual) than European origin fish (five agents; mean 0.9 agents per individual; GLM: p = 0.004; Fig. 3). Among marine-collected fish, all agents detected in the European origin group (Parvicapsula pseudobranchicola, Tetracapsuloides bryosalmonae, Paranucleospora theridion, Candidatus Piscichlamydia salmonis, and PRV-1) were also detected in the North American origin group; four additional agents were detected in the North American group (Ichthyophonus hoferi, Sphaerothecum destruens, ISAV, viral encephalopathy, and retinopathy virus (VERV)). Mean RIB was greater for North American origin marine fish (0.23) than European origin (0.14), but not significantly different (F = 0.81, p = 0.37). In the marine environment, prevalence among European origin fish was dominated by T. bryosalmonae, whereas P. pseudobranchicola was the most prevalent agent among North American fish (Fig. 3). Half of the European origin fish had positive detections of T. bryosalmonae (49%), whereas P. theridion (19%), P. pseudobranchicola (11%), Ca. P. salmonis (5%), and PRV-1 (3%) were detected at lower prevalence. North American origin fish also carried P. pseudobranchicola (58%), T. bryosalmonae (33%), and P. theridion (33%) at moderate prevalence, whereas Ca. P. salmonis (8%), I. hoferi (6%), PRV-1 (6%), ISAV (6%), VERV (3%), and S. destruens (3%) were detected at lower prevalence. Except for T. bryosalmonae (European origin loads were greater; F = 5.07, p = 0.032), agent loads were similar between continental origin groups at sea (nonsignificant at p > 0.05 or insufficient detections for comparison).
Adult Atlantic salmon were collected from freshwater and brackish sites in the Magaguadavic (N = 17), Restigouche (N = 30), and St. John (N = 30) rivers in eastern Canada (Fig. 1). Aquaculture escapees sampled in the Magaguadavic River (multi-tissue) were unique in their infection profiles, which included three viruses, one bacterial species, and three other microparasites (Fig. 3). The Magaguadavic infection profile more closely resembled that of marine-collected fish than the wild river-sampled groups. Among escapees, PRV-1 was the most prevalent agent (76%), followed by ASCV (59%), Ca. P. salmonis (53%), and P. pseudobranchicola (41%), T. bryosalmonae (29%), salmonid gill poxvirus (SGPV) (12%), and P. theridion (6%).
The infection profile of returning adults from the St. John population (gill tissue only, threatened population with high aquaculture influence) was similar to those from the Restigouche River population, but with slightly lower richness (six agents). Agents detected in St. John fish included Flavobacterium psychrophilum (63%), I. hoferi (33%), Ca. P. salmonis (30%), P. theridion (13%), P. pseudobranchicola (10%), and Aeromonas salmonicida (10%).
The Restigouche population (multi-tissue, low aquaculture influence) had the greatest infectious agent richness of freshwater-sampled groups (eight agents), which included all agents detected in the St. John population plus additional bacterial, viral, and myxozoan agents. Among Restigouche fish, I. hoferi (50%), and P. pseudobranchicola (47%) were detected in approximately half of the sampled population, whereas Ca. P. salmonis (37%), F. psychrophilum (37%), P. theridion (33%), and A. salmonicida (23%) occurred at moderate prevalence, and salmon Candidatus Syngnamydia salmonis (13%) and ASCV (3%) at low prevalence.
The primary characteristics that differentiated infection profiles among river-collected groups were the enhanced viral richness and T. bryosalmonae prevalence in the Magaguadavic River sampled escapees relative to wild populations and the lower infectious agent richness in the St. John population. Infectious agent richness of the St. John population (mean = 1.6) was significantly lower than that of the Restigouche population (mean = 2.5; GLM: p = 0.02), whereas the escapee richness (Magaguadavic: mean = 2.8) was most similar to the Restigouche group (p = 0.45), but with very different agent composition. No significant differences in individual agent loads were identified, either due to low sample sizes (low power due to few positive detections) or nonsignificant ANOVA results. RIB was lowest overall in the St. John population but did not significantly differ among river-sampled groups (ANOVA: p = 0.51; Table 3).

PRV and ISAV sequence analysis

Analysis of segment six of the ISAV genome revealed that the strain identity in two North American origin fish at sea belonged to the “European” genotype (Gagné and LeBlanc 2018). One isolate (J3577) included the full-length HPR0 (identified by the absence of a deletion on segment six of the genome); the other isolate (J3574) did not have HPR coverage to reveal type.
From the PRV NGS analysis, a reference-guided assembly of J3575_NAM generated 228 846 total alignments (7.8% of total reads) to the Norwegian PRV Salmo/GP-2010/NOR 10 segment reference genome (Palacios et al. 2010), which resulted in 100× coverage for >99% of the genome and an average depth of 2568 reads. J3611_EUR generated 635 925 total alignments (25.7% of total reads) to the reference genome, which resulted in 100× coverage for >99% of the genome with an average depth of 7009 reads. Finally, J3542_MAG generated 7762 total alignments (0.3% of total reads) to the reference genome, which resulted in 30× coverage for >79% of the genome with an average depth of 85 reads. Over all three samples, segments M2 (outer shell) and S1 (outer clamp/NS p13) displayed the greatest variation relative to the reference genome (97.2%/60–61 SNPs and 96.8%–97.2%/30–35 SNPs, respectively). For J3575_NAM and J3611_EUR, segments S3 (NS RNA) and L1 (core shell) displayed the least variation (99.5%/6 SNPs and 99.3%/28 SNPs, respectively), whereas for J3542_MAG, segments L3 (core RdRp) and L1 (core shell) displayed the least variation relative to the reference genome (99.6%/17 SNPs and 99.4%/23 SNPs, respectively).
BLAST searches and phylogenetic analysis of the S1 segment reveal that all three samples cluster with PRV-1a along with all other Canadian strains to date (Figs. 4, S1). The PRV genome sequences of J3575_NAM and J3611_EUR were virtually identical over all segments except for one SNP in both L3 (core RdRp) and S1 (outer clamp/NS p13; Fig. 4). These sequences were isolated from Atlantic salmon sampled at Maniitsoq market in September 2017 and Paamiut market in September 2016, respectively, after being caught in offshore marine waters near Greenland. The PRV genome sequence of J3542_MAG (aquaculture escapee caught in the Magaguadavic River in September 2017) was >99.0% homologous to the two Greenland-collected samples across all segments with the exception of segment M3 (NS factory), which was a 98.9% homologous. PRV isolates from the two marine-collected (Greenland) hosts clustered with wild and cultured Atlantic salmon from Norway (Garseth et al. 2013), wild fish from Denmark, and cultured fish in the Faroe Islands (Denmark). Alternatively, the escapee isolate J3542_MAG was most similar in the S1 segment (99.7%) to VT03022017-69 (accession No. MF946300) isolated from an Atlantic salmon recovered after escaping a farm near McNutts Island, Nova Scotia, Canada, in March 2017 (Kibenge et al. 2017; F. Kibenge, personal communication).
Fig. 4.
Fig. 4. PRV-1 phylogeny based on publicly available sequences trimmed to the shortest sequence included (732 nucleotides). Tip labels correspond to GenBank Accession numbers. Tip point shapes and colors correspond to the host and country of where each sample was collected. Samples collected in this study are labelled red (MN106306–MN106308).

Discussion

We used HT-qPCR and viral sequencing to characterize variability in the infectious agent profiles and potential transmission dynamics of wild and cultured Atlantic salmon. We identified 14 agents in the tissues of salmon collected as sub-adults in the Labrador Sea near Greenland or as mature adults in three eastern Canadian rivers. Five of these agents, to our knowledge, have not been described as occurring in eastern Canada in peer-reviewed or publicly available literature, which included two bacteria (Ca. P. salmonis and Ca. S. salmonis), one virus (ASCV), one microsporidian (P. theridion), and one myxozoan parasite species (P. pseudobranchicola). SGPV and PRV-1 have only been reported to the International Council for the Exploration of the Sea (ICES) as occurring in this region (ICES 2018), and the S1 segment sequence of PRV-1 was isolated from a fish in Nova Scotia and is available in GenBank, but its geographic source is labeled only as “Canada” (Kibenge et al. 2017; F. Kibenge, personal communication 2019). To our knowledge, this is the first publication of the full genome sequence for PRV obtained from hosts collected in eastern Canada. Our results identify several opportunities for future research and a need to improve our knowledge of infectious agent transmission dynamics and disease potential among wild and cultured Atlantic salmon.
There were three key findings in this study. First, we identified both North American and European origin fish in marine waters off the coast of Greenland, providing further evidence to support this feeding area as a multi-continental melting pot (Hansen and Quinn 1998; Sheehan et al. 2012; Chaput et al. 2019). The similar infectious agent composition between North American and European origin hosts sampled in Greenland, and the finding of virtually identical PRV-1 genome sequences in fish of different continental origins supports the hypothesis of inter-continental transmission of pathogens in North Atlantic feeding areas where stocks mix (Madhun et al. 2018; Vendramin et al. 2019). Second, the high degree of similarity of the PRV-1 genome sequenced from two independent aquaculture escapees in eastern Canada suggests a common source or transmission of PRV-1 within aquaculture facilities that was distinct from the two wild fish sequenced in this study. Third, we found no significant effect of aquaculture proximity on infection profiles of wild returning adult salmon sampled in the St. John and Restigouche rivers of New Brunswick, Canada. Below we present an expanded discussion around these three findings.

Marine transmission potential between continental stocks

Phylogenetic analysis of the three PRV-1 detections sequenced in our study has uncovered potential transmission pathways for PRV-1 (and possibly other agents) between Europe and the Atlantic coast of North America. Nearly identical sequences of PRV-1 were isolated from European and North American origin fish sampled from marine feeding grounds near Greenland. This finding supports the hypothesis that ocean feeding grounds, where fish from different continents converge, provide a natural pathway of agent transmission between Europe and North America (Gagné and LeBlanc 2018; Madhun et al. 2018; Vendramin et al. 2019). We found high homology between sequences of PRV-1 isolated from two escaped farm salmon in eastern Canada in 2017, one collected from the Magaguadavic River in New Brunswick (this study) and the other recovered in Shelburne Harbour, Nova Scotia (Kibenge et al. 2017; F. Kibenge, personal communication). PRV-1 S1 sequences from both aquaculture escapees differed from those isolated from wild fish at sea (Greenland-collected), and PRV-1 was not detected in either wild river-sampled population in this study. It is worth noting that the PRV-1 variants observed both in Greenland and in eastern Canada all clustered with the Norwegian “wild-type” variant, classified in some studies as PRV-1a (Kibenge et al. 2019) that, based on the S1 segment, is divergent from PRV-1b, has been proposed to be of higher virulence (Dhamotharan et al. 2019) and has been shown to be the causative agent of heart and skeletal muscle inflammation (HSMI) (Wessel et al. 2017). However, HSMI has been diagnosed in farmed Atlantic salmon in western Canada in association with PRV-1a (Di Cicco et al. 2017). We propose that natural routes of transcontinental transmission favor movements of less virulent pathogen strains, allowing more time, for example, for European source hosts to migrate to sea and transmit the virus to North American hosts, and for infected North American hosts to then survive their migration back to natal rivers, thereby completing the cycle of intercontinental exchange.
We detected and confirmed with genome sequencing the avirulent HPR0 strain of ISAV in a North American origin fish collected at sea near Greenland. ISAV is in the family Orthomyxoviridae and the virulent form of the virus (HPRΔ) can be highly pathogenic in aquaculture settings (Lovely et al. 1999). ISAV was first detected in Atlantic Canada in 1996, with sequence analysis showing three separate emergences in North America, including avirulent (HPR0) and virulent (HPRΔ) forms (Gagné and LeBlanc 2018). The virus has been observed in wild and cultured salmon in eastern Canada and the USA (Bouchard et al. 1999 2001; Ritchie et al. 2001; Olivier 2002) and detected at low prevalence (<1%) in escaped aquaculture fish in Norway (Madhun et al. 2017). In wild fish, most if not all detections have shown no evidence of disease (including challenged hosts); therefore, it is assumed to be the avirulent HRP0 strain that is affecting asymptomatic wild hosts (Plarre et al. 2005; Gustafson et al. 2018). It is not known whether wild fish have been affected by virulent strains of ISAV, which can develop spontaneously from the avirulent strain through a deletion in segment 6 (Nylund et al. 2003; Godoy et al. 2013). The virulent strain causes acute disease and is therefore unlikely to be detected in sampling of wild fish. No detections of ISAV were found in European origin fish; therefore, we could not compare ISAV sequences between hosts of different continental origins to characterize the potential for its intercontinental exchange at marine feeding areas.
Another virus, VERV, was detected in one North American origin fish at sea. This piscine nodavirus has a wide geographic range, including coastal waters of New Brunswick, Canada, where it has been described at extremely low prevalence in wild winter flounder (Pleuronectes americanus) (Barker et al. 2002). Susceptibility of Atlantic salmon to VERV infection and disease has been demonstrated following intraperitoneal challenge (Korsnes et al. 2005) but not via cohabitation (Korsnes et al. 2012). The detection of VERV in an Atlantic salmon in eastern Canada and at low prevalence and variable loads in wild and farmed salmon in western Canada (Tucker et al. 2018; Laurin et al. 2019) warrants its continued monitoring in wild fish to confirm low susceptibility and virulence.
Among fish collected in Greenland, overall infection profiles were quite similar between continental stock origin groups, generally including the same agents but at a higher richness in North American origin fish. Key differences between European and North American stocks were associated with the prevalence of T. bryosalmonae and P. pseudobranchicola. Tetracapsuloides bryosalmonae is a prevalent parasite endemic in eastern Canada (Khan 2009) that can cause proliferative kidney disease, primarily at elevated water temperatures (Bettge et al. 2009). The absence of this agent in returning adult salmon in this study is interesting given its moderate prevalence in fish at sea. Parvicapsula pseudobranchicola is a prevalent myxosporean parasite originally characterized in Norway and newly detected in eastern Canada; it affects the pseudobranch of fishes as a generally low-virulence agent but can cause runting in cultured fish (Nylund et al. 2018). Both of these parasites cannot be horizontally transmitted at sea (Morris and Adams 2006; Nylund et al. 2018), so disparate relative prevalence of these two agents depending on continental origin (freshwater stage) is unsurprising.

Infection profiles of wild and escaped farm salmon in rivers

Among adult salmon in three New Brunswick rivers, the infection profile of a group of aquaculture escapees in the Magaguadavic River was unique relative to two wild salmon populations from the Restigouche and St. John rivers. Contrary to our expectation that proximity to aquaculture would enhance infection severity of wild populations through acquisition of agents that thrive in culture settings, infectious agent loads and richness were highest in the Restigouche population, which was furthest from aquaculture influence. St. John fish could only be nonlethally sampled for gill as opposed to gill, heart, and kidney from Restigouche and escapee fish. However, gill has been shown to have equal or greater infectious agent richness than multi-tissue pools (Teffer and Miller 2019). Only one virus, ASCV, was detected (in just one host) in the Restigouche River. The only other fish with ASCV detections in this study were aquaculture escapees. ASCV is common in Norwegian fish culture (Mikalsen et al. 2014) and is the most commonly detected virus in farmed salmon in western Canada (K. Miller, unpublished data). ASCV is often detected as a coinfection with other agents (e.g., with PRV), but studies to date have had variable and often inconclusive findings for its independent pathological effects (Mikalsen et al. 2014; Wiik-Nielsen et al. 2016). Interestingly, a related fish calcicivirus in baitfish was associated with clinical disease only when coinfected with a second virus (Mor et al. 2017). Given its widespread prevalence, future studies should evaluate sequence variation among ASCV isolates across geographic regions and examine the potential role ASCV plays in disease progression in coinfections.
Aquaculture escapees had the second highest overall infectious agent richness with few bacterial species and the highest prevalence of viruses of any group. Greater than half of escapees carried PRV-1 and ASCV, often as coinfections; for example, most fish positive for ASCV were also positive for PRV-1, and both SGPV-positive hosts were also positive for PRV-1 and ASCV. SGPV has previously been described in Norway and the Northeast Atlantic Ocean (Nylund et al. 2008; Garseth et al. 2018). In this study, we detected SGPV solely in escaped aquaculture fish, and its occurrence in eastern Canada has been reported to the ICES (ICES 2018). The composition of bacterial and microparasite species hosted by aquaculture escapees was more similar to marine-collected than river-sampled fish, despite hosts being collected in a freshwater environment (i.e., exposed to freshwater infectious agents). Closer alignment of infection profiles between escapees and marine-collected fish may be due to aquaculture practices that inhibit some infections (e.g., antibiotics for bacterial agents) as well as alternate dietary sources (e.g., fish feed versus wild, potentially infected prey) and extended coastal residence.
Microparasite species composition in wild Atlantic salmon in the Restigouche and St. John rivers was highly congruent with infection profiles described in adult Pacific salmon in western Canadian rivers (Bass et al. 2017; Teffer et al. 2017). Exceptions to this included T. bryosalmonae and S. destruens, which were absent in river-collected Atlantic salmon in this study. The consistent prevalence of P. theridion (aka Desmozoon lepeophtherii, a candidate causative agent of proliferative gill inflammation) across sampling locations in this study aligns with the widespread occurrence of its alternate sea louse host (Lepeophtheirus salmonis) in eastern Canada (Carr and Whoriskey 2004; Sveen et al. 2012). High prevalence among wild Atlantic salmon in this study suggests that P. theridion is not highly virulent in this system. Lower prevalence of this agent among marine-collected fish versus freshwater adults supports adult infections as enhanced in the nearshore environment (Hendricks 1972; Rand 1992). The relatively low prevalence (one fish) of P. theridion in aquaculture escapees is interesting and potentially due to farm practices that inhibit exposure or spore development (e.g., low-temperature environment) (Sanchez et al. 2000; Sveen et al. 2012). We were unable to find any peer-reviewed literature describing the presence of P. theridion in eastern Canada despite records of its occurrence and association with sea lice in Scotland, Norway, and the eastern Pacific (Freeman and Sommerville 2011; Nylund et al. 2011; Jones et al. 2012; Sveen et al. 2012; Miller et al. 2014). Ichthyophonus hoferi, a protistan parasite, was detected at moderate prevalence among wild salmon in both rivers and is endemic in the Northwest Atlantic Ocean and coastal waters of eastern Canada (Hendricks 1972; Rand and Cone 1990; Rand 1992). Ecological impacts of this agent should be explored as Ichthyophonus spp. infections can affect host swimming ability, especially under suboptimal environmental conditions (e.g., high temperature) (Tierney and Farrell 2004; Kocan et al. 2009).
The Restigouche and St. John populations hosted two Chlamydiae species (Ca. P. salmonis and Ca. S. salmonis) that have not yet been described in eastern Canada. Candidatus Syngnamydia salmonis is a newly described species potentially associated with gill disease in Norway (Nylund et al. 2015) and has been detected intermittently among wild and aquaculture salmon on the west coast of Canada (Miller et al. 2014; Thakur et al. 2018). Candidatus Piscichlamydia salmonis is known to affect Atlantic salmon in aquaculture (Norway, Ireland) and farmed Arctic char (Salvelinus alpinus) in the USA and Canada (Draghi et al. 2004, 2010). The loads of these bacteria described in this study are unlikely to have been pathogenic, as the density of epitheliocysts would need to be extremely high to affect cell function and host respiration (Pawlikowska-Warych and Deptuła 2016). Other bacterial species detected in this study included F. psychrophilum and A. salmonicida. Flavobacterium psychrophilum is a common bacterial agent with a global distribution across temperate zones; its virulent strains can be pathogenic at low temperatures (<16 °C) (Holt 1987; Nilsen et al. 2014). Aeromonas salmonicida is the causative agent of furunculosis, endemic in eastern Canada (Foda 1973) and can be highly virulent. Preventative vaccination for A. salmonicida is generally applied in aquaculture (Mitchell and Rodger 2011), which may explain the absence of these bacteria in escapees in this study. Both of these bacterial agents can contribute to secondary infections following dermal injury (Svendsen and Bøgwald 1997; Janda and Abbott 2010; Starliper 2011; Teffer et al. 2017).

Conclusions

We present for the first time a quantitative molecular screening of dozens of infectious agents in wild and escaped Atlantic salmon in offshore feeding areas of the Northwest Atlantic Ocean and three eastern Canadian rivers. Our results offer baseline coinfection and viral phylogenic data that provide insight into potential transmission dynamics among wild Atlantic salmon stocks at sea and evidence to support natural incursion of infectious agents from Europe to North America. Continued study of marine infection dynamics is warranted to confirm this natural transatlantic transmission route for infectious agents, which would introduce a managerial challenge for infectious disease control if pathogenic effects result from this exchange.
This study was undertaken to improve baseline knowledge of infectious agents carried by wild and escaped cultured Atlantic salmon and investigate transmission potential through the use of phylogenetic analysis of viral isolates. We cannot assign pathology to any infectious agents detected in our study as host health and performance were not evaluated. As with any study of wild animals, it is also possible that heavily infected fish or those carrying highly pathogenic agents died or were predated prior to sampling (Miller et al. 2014). We were limited in our comparative analysis because of disparity in tissue types sampled across sites but included these informative results as a starting point for future hypothesis testing on transmission dynamics in eastern Canadian waters. Our understanding of the mechanisms and frequency of infectious agent transmission among wild fishes is still in its infancy, especially for highly migratory and offshore marine hosts like Atlantic salmon and for pathogens that can cross continental borders via marine exchange. Molecular tools can be used to rapidly advance this knowledge and, combined with telemetry approaches and experimental studies, can improve our understanding of the disease ecology of Atlantic salmon throughout their range.

Acknowledgements

We would like to acknowledge and thank the fish market employees in Maniitsoq and Paamiut, Greenland, who provided us with a space to sample as well as their help and collaboration, and special thanks to the fishermen who participated in this study, including those in Paamiut (Jens Hanseeraq Kleist and Fritz Mikaelsen) and Maniitsoq (Efraim Heilmann, Frans Petersen, Daniel Heilmann, Hendrik Heilmann, and Qulutannguaq Moller). Restigouche River samples were provided by Listuguj fishers who collaborated closely with Dr. Gillis to meaningfully contribute to this study.

References

Alizon S, de Roode JC, and Michalakis Y. 2013. Multiple infections and the evolution of virulence. Ecology Letters, 16: 556–567.
Altschul SF, Gish W, Miller W, Myers EW, and Lipman DJ. 1990. Basic local alignment search tool. Journal of Molecular Biology, 215: 403–410.
Andersen L, Bratland A, Hodneland K, and Nylund A. 2007. Tissue tropism of salmonid alphaviruses (subtypes SAV1 and SAV3) in experimentally challenged Atlantic salmon (Salmo salar L.). Archives of Virology, 152: 1871–1883.
Archie EA, Luikart G, and Ezenwa VO. 2009. Infecting epidemiology with genetics: a new frontier in disease ecology. Trends in Ecology & Evolution, 24: 21–30.
Bakke TA, and Harris PD. 1998. Diseases and parasites in wild Atlantic salmon (Salmo salar) populations. Canadian Journal of Fisheries and Aquatic Sciences, 55: 247–266.
Bankevich A, Nurk S, Antipov D, Gurevich AA, Dvorkin M, Kulikov AS, et al. 2012. SPAdes: a new genome assembly algorithm and its applications to single-cell sequencing. Journal of Computational Biology, 19: 455–477.
Barker DE, MacKinnon AM, Boston L, Burt MDB, Cone DK, Speare DJ, et al. 2002. First report of piscine nodavirus infecting wild winter flounder Pleuronectes americanus in Passamaquoddy Bay, New Brunswick, Canada. Diseases of Aquatic Organisms, 49: 99–105.
Bass AL, Hinch SG, Teffer AK, Patterson DA, and Miller KM 2017. A survey of microparasites present in adult migrating Chinook salmon (Oncorhynchus tshawytscha) in south-western British Columbia determined by high-throughput quantitative polymerase chain reaction. Journal of Fish Diseases, 40: 453–477.
Bass AL, Hinch SG, Teffer AK, Patterson DA, and Miller KM. 2019. Fisheries capture and infectious agents were associated with travel rate and survival of Chinook salmon during spawning migration through a natal river. Fisheries Research, 209: 156–166.
Benson DA, Karsch-Mizrachi I, Lipman DJ, Ostell J, and Wheeler DL. 2003. GenBank. Nucleic Acids Research, 31: 23–27.
Bettge K, Wahli T, Segner H, and Schmidt-Posthaus H. 2009. Proliferative kidney disease in rainbow trout: time- and temperature-related renal pathology and parasite distribution. Diseases of Aquatic Organisms, 83: 67–76.
Bolger AM, Lohse M, and Usadel B. 2014. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics, 30: 2114–2120.
Bouchard D, Keleher W, Opitz HM, Blake S, Edwards KC, and Nicholson BL. 1999. Isolation of infectious salmon anemia virus (ISAV) from Atlantic salmon in New Brunswick, Canada. Diseases of Aquatic Organisms, 35: 131–137.
Bouchard DA, Brockway K, Giray C, Keleher W, and Merrill PL. 2001. First report of Infectious Salmon Anemia (ISA) in the United States. Bulletin of The European Association of Fish Pathologists, 21: 86–88.
Brassard P, Rau ME, and Curtis MA. 1982. Parasite-induced susceptibility to predation in diplostomiasis. Parasitology, 85, 495–501.
Burge CA, Mark Eakin C, Friedman CS, Froelich B, Hershberger PK, Hofmann EE, et al. 2014. Climate change influences on marine infectious diseases: implications for management and society. Annual Review of Marine Science, 6: 249–277.
Carr J. 1995. Interactions between wild and aquaculture atlantic salmon in the Magaguadavic River, New Brunswick. M.Sc. thesis, University of New Brunswick, Fredericton. 77 p.
Carr J, and Whoriskey F. 2004. Sea lice infestation rates on wild and escaped farmed Atlantic salmon (Salmo salar L.) entering the Magaguadavic River, New Brunswick. Aquaculture Research, 35: 723–729.
Castellani M, Heino M, Gilbey J, Araki H, Svåsand T, and Glover KA. 2018. Modeling fitness changes in wild Atlantic salmon populations faced by spawning intrusion of domesticated escapees. Evolutionary Applications, 11: 1010–1025.
Chaput G, Carr J, Daniels J, Tinker S, Jonsen I, and Whoriskey, F. 2018. Atlantic salmon (Salmo salar) smolt and early post-smolt migration and survival inferred from multi-year and multi-stock acoustic telemetry studies in the Gulf of St. Lawrence, northwest Atlantic. ICES Journal of Marine Science, 76: 1107–1121.
Clouthier S, Schroeder T, McClure C, Lindsay M, Khatkar S, Collette-Belliveau C, et al. 2014. Development and diagnostic validation of a reverse transcription quantitative PCR (RT-qPCR) assay for detection of infectious pancreatic necrosis virus (IPNV). In 7th International Symposium on Aquatic Animal Health ISAAH, Portland, Oregon.
Collins CM, Kerr R, Mcintosh R, and Snow M. 2010. Development of a real-time PCR assay for the identification of Gyrodactylus parasites infecting salmonids in northern Europe. Diseases of Aquatic Organisms, 90: 135–142.
Corbeil S, McColl KA, and Crane MSJ. 2003. Development of a TaqMan quantitative PCR assay for the identification of Piscirickettsia salmonis. Bulletin of the European Association of Fish Pathologists, 23: 95–101.
Davidson WS, Koop BF, Jones SJM, Iturra P, Vidal R, Maass A, et al. 2010. Sequencing the genome of the Atlantic salmon (Salmo salar). Genome Biology, 11: 403.
Dhamotharan K, Tengs T, Wessel Ø, Braaen S, Rimstad E, and Markussen T. 2019. Evolution of the Piscine orthoreovirus genome linked to emergence of heart and skeletal muscle inflammation in farmed Atlantic salmon. Viruses, 11: 465.
Di Cicco E, Ferguson HW, Schulze AD, Kaukinen KH, Li S, Vanderstichel R, et al. 2017. Heart and skeletal muscle inflammation (HSMI) disease diagnosed on a British Columbia salmon farm through a longitudinal farm study, PLoS ONE, 12: e0171471.
Di Cicco E, Ferguson HW, Kaukinen KH, Schulze AD, Li S, Tabata A, et al. 2018. The same strain of piscine orthoreovirus (PRV-1) is involved in the development of different, but related, diseases in Atlantic and Pacific Salmon in British Columbia. Facets, 3: 599–641.
Downes JK, Yatabe T, Marcos-Lopez M, Rodger HD, Maccarthy E, O’Connor I, et al. 2018. Investigation of co-infections with pathogens associated with gill disease in Atlantic salmon during an amoebic gill disease outbreak. Journal of Fish Diseases, 41: 1217–1227.
Draghi AII, Popov VL, Kahl MM, Stanton JB, Brown CC, Tsongalis GJ, et al. 2004. Characterization of “Candidatus Piscichlamydia salmonis” (Order Chlamydiales), a Chlamydia-like bacterium associated with epitheliocystis in farmed Atlantic salmon (Salmo salar). Archives of Microbiology, 42: 5286–5297.
Draghi AII, Bebak J, Daniels S, Tulman ER, Geary SJ, West AB, et al. 2010. Identification of “Candidatus Piscichlamydia salmonis” in Arctic charr Salvelinus alpinus during a survey of charr production facilities in North America. Diseases of Aquatic Organisms, 89: 39–49.
Duesund H, Nylund S, Watanabe K, Ottem KF, and Nylund A. 2010. Characterization of a VHS virus genotype III isolated from rainbow trout (Oncorhychus mykiss) at a marine site on the west coast of Norway. Virology Journal, 7: 19.
Edgar RC. 2004. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Research, 32: 1792–1797.
Foda A. 1973. Changes in hematocrit and hemoglobin in Atlantic Salmon (Salmo salar) as a result of furunculosis disease. Journal of the Fisheries Research Board of Canada, 30: 467–468.
Freeman MA, and Sommerville C. 2011. Original observations of Desmozoon lepeophtherii, a microsporidian hyperparasite infecting the salmon louse Lepeophtheirus salmonis, and its subsequent detection by other researchers. Parasites and Vectors, 4: 231.
Fringuelli E, Gordon AW, Rodger H, Welsh MD, and Graham DA. 2012a. Detection of Neoparamoeba perurans by duplex quantitative taqman real-time PCR in formalin-fixed, paraffin-embedded atlantic salmonid gill tissues. Journal of Fish Diseases, 35: 711–724.
Fringuelli E, Savage PD, Gordon A, Baxter EJ, Rodger HD, and Graham DA. 2012b. Development of a quantitative real-time PCR for the detection of Tenacibaculum maritimum and its application to field samples. Journal of Fish Diseases, 35: 579–590.
Gagné N, and LeBlanc F. 2018. Overview of infectious salmon anaemia virus (ISAV) in Atlantic Canada and first report of an ISAV North American-HPR0 subtype. Journal of Fish Diseases, 41: 421–430.
Garseth ÅH, Ekrem T, and Biering E. 2013. Phylogenetic evidence of long distance dispersal and transmission of piscine reovirus (PRV) between farmed and wild Atlantic salmon. PLoS ONE, 8: e82202.
Garseth ÅH, Gjessing MC, Moldal T, and Gjevre AG. 2018. A survey of salmon gill poxvirus (SGPV) in wild salmonids in Norway. Journal of Fish Diseases, 41: 139–145.
Gjessing MC, Yutin N, Tengs T, Senkevich T, Koonin E, Rønning HP, et al. 2015. Salmon gill poxvirus, the deepest representative of the Chordopoxvirinae. Journal of Virology, 89: 9348–9367.
Godoy MG, Kibenge MJ, Suarez R, Lazo E, Heisinger A, Aguinaga J, et al. 2013. Infectious salmon anaemia virus (ISAV) in Chilean Atlantic salmon (Salmo salar) aquaculture: emergence of low pathogenic ISAV-HPR0 and re-emergence of virulent ISAV-HPR: HPR3 and HPR14. Virology Journal, 10: 344.
Gustafson LL, Creekmore LH, Snekvik KR, Ferguson JA, Warg JV, Blair M, et al. 2018. A systematic surveillance programme for infectious salmon anaemia virus supports its absence in the Pacific Northwest of the United States. Journal of Fish Diseases, 41: 337–346.
Hallett SL, and Bartholomew JL. 2006. Application of a real-time PCR assay to detect and quantify the myxozoan parasite Ceratomyxa shasta in river water samples. Diseases of Aquatic Organisms, 71: 109–118.
Hallett SL, and Bartholomew JL. 2009. Development and application of a duplex QPCR for river water samples to monitor the myxozoan parasite Parvicapsula minibicornis. Diseases of Aquatic Organisms, 86: 39–50.
Hansen LP, and Quinn TP. 1998. The marine phase of the Atlantic salmon (Salmo salar) life cycle, with comparisons to Pacific salmon. Canadian Journal of Fisheries and Aquatic Sciences, 55: 104–118.
Heggberget TG, Johnsen BO, Hindar K, Jonsson B, Hansen LP, Hvidsten NA, et al. 1993. Interactions between wild and cultures Atlantic salmon: a review of the Norwegian experience. Fisheries Research, 18: 123–146.
Hendricks JD. 1972. Two new host species for the parasitic fungus Ichthyophonus hoferi in the Northwest Atlantic. Journal of Fisheries Research Board Canada, 29: 1776–1777.
Holt RA. 1987. Cytophaga psychrophila, the causative agent of bacterial coldwater disease in salmonid fish. Ph.D. thesis, Oregon State University, Corvallis, Oregon.
ICES. 2018. Report of the Working Group on Pathology and Diseases of Marine Organisms (WGPDMO). ICES CM 2018/ASG:01. Riga, Latvia.
Janda JM, and Abbott SL. 2010. The genus Aeromonas: taxonomy, pathogenicity, and infection. Clinical Microbiology Reviews, 23: 35–73.
Jeffery NW, Wringe BF, McBride MC, Hamilton LC, Stanley RRE, Bernatchez L, et al. 2018. Range-wide regional assignment of Atlantic salmon (Salmo salar) using genome wide single-nucleotide polymorphisms. Fisheries Research, 206: 163–175.
Jeffries KM, Hinch SG, Gale MK, Clark TD, Lotto AG, Casselman MT, et al. 2014. Immune response genes and pathogen presence predict migration survival in wild salmon smolts. Molecular Ecology, 23: 5803–5815.
Johansen L-H, Jensen I, Mikkelsen H, Bjørn Pa, Jansen Pa, and Bergh Ø. 2011. Disease interaction and pathogens exchange between wild and farmed fish populations with special reference to Norway. Aquaculture, 315: 167–186.
Johnson PTJ, de Roode JC, and Fenton A. 2015. Why infectious disease research needs community ecology. Science, 349: 1259504–1259504.
Jones SRM, Prosperi-Porta G, and Kim E. 2012. The diversity of microsporidia in parasitic copepods (Caligidae: Siphonostomatoida) in the northeast Pacific Ocean with description of Facilispora margolisi n. g., n. sp. and a new family Facilisporidae n. fam. Journal of Eukaryotic Microbiology, 59: 206–217.
Jonsson B, and Jonsson N. 2011. Ecology of Atlantic salmon and brown trout: habitat as a template for life histories. Springer, New York, New York.
Jonstrup SP, Kahns S, Skall HF, Boutrup TS, and Olesen NJ. 2013. Development and validation of a novel Taqman-based real-time RT-PCR assay suitable for demonstrating freedom from viral haemorrhagic septicaemia virus. Journal of Fish Diseases, 36: 9–23.
Jørgensen A, Nylund A, Nikolaisen V, Alexandersen S, and Karlsbakk E. 2011. Real-time PCR detection of Parvicapsula pseudobranchicola (Myxozoa: Myxosporea) in wild salmonids in Norway. Journal of Fish Diseases, 34: 365–371.
Keeling SE, Johnston C, Wallis R, Brosnahan CL, Gudkovs N, and McDonald WL. 2012. Development and validation of real-time PCR for the detection of Yersinia ruckeri. Journal of Fish Diseases, 35: 119–125.
Keeling SE, Brosnahan CL, Johnston C, Wallis R, Gudkovs N, and McDonald WL. 2013. Development and validation of a real-time PCR assay for the detection of Aeromonas salmonicida. Journal of Fish Diseases, 36: 495–503.
Khan RA. 2009. Parasites causing disease in wild and cultured fish in Newfoundland. Icelandic Agricultural Sciences, 22: 29–35.
Kibenge FSB, Kibenge MJT, and Morton A. 2017. Piscine reovirus segment S1 sequences from fish samples from British Columbia-Canada. Direct submissions to Genbank database.
Kibenge MJT, Wang Y, Gayeski N, Morton A, Beardslee K, McMillan B, et al. 2019. Piscine orthoreovirus sequences in escaped farmed Atlantic salmon in Washington and British Columbia. Virology Journal, 16: 41.
Klemetsen A, Amundsen P-A, Dempson JB, Jonsson B, Jonsson N, O’Connell MF, et al. 2003. Atlantic salmon Salmo salar L., brown trout Salmo trutta L. and Arctic charr Salvelinus alpinus (L.): a review of aspects of their life histories. Ecology of Freshwater Fish, 12: 1–59.
Kocan R, Hershberger PK, Sanders G, and Winton JR. 2009. Effects of temperature on disease progression and swimming stamina in Ichthyophonus-infected rainbow trout, Oncorhynchus mykiss (Walbaum). Journal of Fish Diseases, 32: 835–843.
Korsnes K, Devold M, Nerland AH, and Nylund A. 2005. Viral encephalopathy and retinopathy (VER) in Atlantic salmon Salmo salar after intraperitoneal challenge with a nodavirus from Atlantic halibut Hippoglossus hippoglossus. Diseases of Aquatic Organisms, 68: 7–15.
Korsnes K, Karlsbakk E, Nylund A, and Nerland AH. 2012. Horizontal transmission of nervous necrosis virus between turbot Scophthalmus maximus and Atlantic cod Gadus morhua using cohabitation challenge. Diseases of Aquatic Organisms, 99: 13–21.
Krkošek M, Connors BM, Morton A, Lewis MA, Dill LM, and Hilborn R. 2011. Effects of parasites from salmon farms on productivity of wild salmon. Proceedings of the National Academy of Sciences of the United States of America, 108: 14700–14704.
Lafferty KD. 2017. Marine infectious disease ecology. Annual Review of Ecology, Evolution, and Systematics, 48: 473–496.
Lafferty KD, Harvell CD, Conrad JM, Friedman CS, Kent ML, Kuris AM, et al. 2015. Infectious diseases affect marine fisheries and aquaculture economics. Annual Review of Marine Science, 7: 471–496.
Laurin E, Jaramillo D, Vanderstichel R, Ferguson H, Kaukinen KH, Schulze AD, et al. 2019. Histopathological and novel high-throughput molecular monitoring data from farmed salmon (Salmo salar and Oncorhynchus spp.) in British Columbia, Canada, from 2011–2013. Aquaculture, 499: 220–234.
LeBlanc F, Laflamme M, and Gagné N. 2010. Genetic markers of the immune response of Atlantic salmon (Salmo salar) to infectious salmon anemia virus (ISAV). Fish and Shellfish Immunology, 29: 217–232.
Lee D-Y, Shannon K, and Beaudette LA. 2006. Detection of bacterial pathogens in municipal wastewater using an oligonucleotide microarray and real-time quantitative PCR. Journal of Microbiological Methods, 65: 453–467.
Li H. 2011. A statistical framework for SNP calling, mutation discovery, association mapping and population genetical parameter estimation from sequencing data. Bioinformatics, 27(21): 2987–2993.
Li H. 2013. Aligning sequence reads, clone sequences and assembly contigs with BWA-MEM. arXiv:1303.3997v1 [q-bio.GN].
Li H, and Durbin R. 2010. Fast and accurate long-read alignment with Burrows-Wheeler transform. Bioinformatics, 26: 589–595.
Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, et al. 2009. The Sequence alignment/map (SAM) format and SAMtools. Bioinformatics, 25(16): 2078–9.
Lloyd SJ, LaPatra SE, Snekvik KR, Cain KD, and Call DR. 2011. Quantitative PCR demonstrates a positive correlation between a Rickettsia-like organism and severity of strawberry disease lesions in rainbow trout, Oncorhynchus mykiss (Walbaum). Journal of Fish Diseases, 34: 701–709.
Lovely JE, Dannevig BH, Falk K, Hutchin L, MacKinnon AM, Melville KJ, et al. 1999. First identification of infectious salmon anaemia virus in North America with haemorrhagic kidney syndrome. Diseases of Aquatic Organisms, 35: 145–148.
Madhun AS, Wennevik V, Karlsbakk E, Skaala Ø, Fiksdal IU, Meier S, et al. 2017. The ecological profile of Atlantic salmon escapees entering a river throughout an entire season: diverse in escape history and genetic background, but frequently virus-infected. ICES Journal of Marine Science, 74: 1371–1381.
Madhun AS, Isachsen CH, Omdal LM, Einen ACB, Mæhle S, Wennevik V, et al. 2018. Prevalence of piscine orthoreovirus and salmonid alphavirus in sea-caught returning adult Atlantic salmon (Salmo salar L.) in northern Norway. Journal of Fish Diseases, 41: 797–803.
Marcogliese DJ. 2008. The impact of climate change on the parasites and infectious diseases of aquatic animals. Revue Scientifique et Technique, 27: 467–484.
Martin SJ, Highfield AC, Brettell L, Villalobos EM, Budge GE, Powell M, et al. 2012. Global honey bee viral landscape altered by a parasitic mite. Science, 336: 1304–1306.
Mikalsen AB, Nilsen P, Frøystad-Saugen M, Lindmo K, Eliassen TM, Rode MR, et al. 2014. Characterization of a novel calicivirus causing systemic infection in Atlantic salmon (Salmo salar L.): proposal for a new genus of caliciviridae. PLoS ONE, 9: e107132.
Miller KM, Teffer AK, Tucker S, Li S, Schulze AD, Trudel M, et al. 2014. Infectious disease, shifting climates, and opportunistic predators: cumulative factors potentially impacting wild salmon declines. Evolutionary Applications, 7: 812–855.
Miller KM, Gardner IA, Vanderstichel R, Burnley T, Angela D, Li S, et al. 2016. Report on the performance evaluation of the Fluidigm BioMark platform for high-throughput microbe monitoring in salmon. DFO Canadian Science Advisory Secretariat Research Document 2016/038, Ottawa, Ontario.
Mitchell SO, and Rodger HD. 2011. A review of infectious gill disease in marine salmonid fish. Journal of Fish Diseases, 34: 411–432.
Mor SK, Phelps NBD, Ng TFF, Subramaniam K, Primus A, Armien AG, et al. 2017. Genomic characterization of a novel calicivirus, FHMCV-2012, from baitfish in the USA. Archives of Virology, 162: 3619–3627.
Morris DJ, and Adams A. 2006. Transmission of Tetracapsuloides bryosalmonae (Myxozoa: Malacosporea), the causative organism of salmonid proliferative kidney disease, to the freshwater bryozoan Fredericella sultana. Parasitology, 133: 701–709.
Morris MRJ, Fraser DJ, Heggelin AJ, Whoriskey FG, Carr JW, O’Neil SF, et al. 2008. Prevalence and recurrence of escaped farmed Atlantic salmon (Salmo salar) in eastern North American rivers. Can. J. Fish. Aquat. Sci. 65: 2807–2826.
Nekouei O, Vanderstichel R, Ming T, Kaukinen KH, Thakur K, Tabata A, et al. 2018. Distribution of infectious agents in juvenile Fraser River Sockeye salmon, Canada, in 2012 and 2013. Diseases of Aquatic Organisms, 9: 1–32.
Nilsen H, Sundell K, Duchaud E, Nicolas P, Dalsgaard I, Madsen L, et al. 2014. Multilocus sequence typing identifies epidemic clones of Flavobacterium psychrophilum in nordic countries. Applied and Environmental Microbiology, 80: 2728–2736.
Nylund A, Devold M, Plarre H, Isdal E, and Aarseth M. 2003. Emergence and maintenance of infectious salmon anaemia virus (ISAV) in Europe: a new hypothesis. Diseases of Aquatic Organisms, 56: 11–24.
Nylund A, Watanabe K, Nylund S, Karlsen M, Sæther PA, Arnesen CE, et al. 2008. Morphogenesis of salmonid gill poxvirus associated with proliferative gill disease in farmed Atlantic salmon (Salmo salar) in Norway. Archives of Virology, 153: 1299–1309.
Nylund A, Hansen H, Brevik ØJ, Hustoft H, Markussen T, Plarre H, et al. 2018. Infection dynamics and tissue tropism of Parvicapsula pseudobranchicola (Myxozoa: Myxosporea) in farmed Atlantic salmon (Salmo salar). Parasites and Vectors, 11: 17.
Nylund S, Nylund A, Watanabe K, Arnesen CE, and Karlsbakk E. 2010. Paranucleospora theridion (Microsporidia, Enterocytozoonidae) with a life cycle in the salmon louse (Lepeophtheirus salmonis, Copepoda) and Atlantic salmon (Salmo salar). Journal of Eukaryotic Microbiology, 57: 95–114.
Nylund S, Andersen L, Sævareid I, Plarre H, Watanabe K, Arnesen CE, et al. 2011. Diseases of farmed Atlantic salmon Salmo salar associated with infections by the microsporidian Paranucleospora theridion. Diseases of Aquatic Organisms, 94: 41–57.
Nylund S, Steigen A, Karlsbakk E, Plarre H, Andersen L, Karlsen M, et al. 2015. Characterization of ‘Candidatus Syngnamydia salmonis’ (Chlamydiales, Simkaniaceae), a bacterium associated with epitheliocystis in Atlantic salmon (Salmo salar L.). Archives of Microbiology, 197: 17–25.
Olivier G. 2002. Disease interactions between wild and cultured fish — perspectives from the American Northeast (Atlantic Provinces). Bulletin of the European Association of Fish Pathologists, 22: 103–109.
Palacios G, Lovoll M, Tengs T, Hornig M, Hutchison S, Hui J, et al. 2010. Heart and skeletal muscle inflammation of farmed salmon is associated with infection with a novel reovirus. PLoS ONE, 5: e11487.
Parrish DL, Behnke RJ, Gephard SR, McCormick SD, and Reeves GH. 1998. Why aren’t there more Atlantic salmon (Salmo salar). Canadian Journal of Fisheries and Aquatic Sciences, 55: 281–287.
Pawlikowska-Warych M, and Deptuła W. 2016. Characteristics of chlamydia-like organisms pathogenic to fish. Journal of Applied Genetics, 57: 135–141.
Peacock SJ. Krkošek M, Proboszcz S, Orr C, and Lewis MA. 2013. Cessation of a salmon decline with control of parasites. Ecological Applications, 23: 606–620.
Plarre H, Devold M, Snow M, and Nylund A. 2005. Prevalence of infectious salmon anaemia virus (ISAV) in wild salmonids in western Norway. Diseases of Aquatic Organisms, 66: 71–79.
Powell M, Overturf K, Hogge C, and Johnson K. 2005. Detection of Renibacterium salmoninarum in Chinook salmon, Oncorhynchus tshawytscha (Walbaum), using quantitative PCR. Journal of Fish Diseases, 28: 615–622.
Price MN, Dehal PS, and Arkin AP. 2010. FastTree 2—approximately maximum-likelihood trees for large alignments. PLoS ONE, 5: e9490.
Purcell MK, Thompson RL, Garver KA, Hawley LM, Batts WN, Sprague L, et al. 2013. Universal reverse-transcriptase real-time PCR for infectious hematopoietic necrosis virus (IHNV). Diseases of Aquatic Organisms, 106: 103–115.
Purcell MK, Pearman-Gillman S, Thompson RL, Gregg JL, Hart LM, Winton JR, et al. 2016. Identification of the major capsid protein of erythrocytic necrosis virus (ENV) and development of quantitative real-time PCR assays for quantification of ENV DNA. Journal of Veterinary Diagnostic Investigation, 28: 382–391.
Rand TG. 1992. Distribution of Ichthyophonus hoferi (Mastigomycotina: Ichthyophonales) in yellowtail flounder, Limanda ferruginea, from the Nova Scotia Shelf, Canada. Journal of the Marine Biological Association of the United Kingdom, 72: 669–674.
Rand TG, and Cone DK. 1990. Effects of Ichthyophonus hoferi on condition indices and blood chemistry of experimentally infected rainbow trout (Oncorhynchus mykiss). Journal of Wildlife Diseases, 26: 323–328.
Reddin DG, and Friedland KD. 1999. A history of identification to continent of origin of Atlantic salmon (Salmo salar L.) at west Greenland, 1969-1997. Fisheries Research, 43: 221–235.
Ritchie RJ, Cook M, Melville K, Simard N, Cusack R, and Griffith S. 2001. Identification of infectious salmon anaemia virus in Atlantic salmon from Nova Scotia (Canada): evidence for functional strain differences. Diseases of Aquatic Organisms, 44: 171–178.
Sanchez JG, Speare DJ, and Markham RJF. 2000. Normal and aberrant tissue distribution of Loma salmonae (Microspora) within rainbow trout, Oncorhynchus mykiss (Walbaum), following experimental infection at water temperatures within and outside of the xenoma-expression temperature boundaries. Journal of Fish Diseases, 23: 235–242.
Selakovic S, de Ruiter PC, and Heesterbeek H. 2014. Infectious disease agents mediate interaction in food webs and ecosystems. Proceedings of the Royal Society B, 281: 20132709.
Sheehan TF, Reddin DG, Chaput G, and Renkawitz MD. 2012. SALSEA Northe America: a pelagic ecosystem survey targeting Atlantic salmon in the Northwest Atlantic. ICES Journal of Marine Science, 69: 1580–1588.
Sofonea MT, Alizon S, and Michalakis Y. 2015. From within-host interactions to epidemiological competition: a general model for multiple infections. Philosophical Transactions of the Royal Society B, 370: 20140303.
Starliper CE. 2011. Bacterial coldwater disease of fishes caused by Flavobacterium psychrophilum. Journal of Advanced Research, 2: 97–108.
Stimson J, Gardy J, Mathema B, Crudu V, Cohen T, and Colijn C. 2019. Beyond the SNP threshold: identifying outbreak clusters using inferred transmissions. Molecular Biology and Evolution, 36: 587–603.
Sveen S, Øverland H, Karlsbakk E, and Nylund A. 2012. Paranucleospora theridion (Microsporidia) infection dynamics in farmed Atlantic salmon Salmo salar put to sea in spring and autumn. Diseases of Aquatic Organisms, 101: 43–49.
Svendsen YS, and Bøgwald J. 1997. Influence of artificial wound and non-intact mucus layer on mortality of Atlantic salmon (Salmo salar L.) following a bath challenge with Vibrio anguillarum and Aeromonas salmonicida. Fish and Shellfish Immunology, 7: 317–325.
Teffer AK, and Miller KM. 2019. A comparison of non-lethal and destructive methods for broad-based infectious agent screening of Chinook Salmon using high-throughput qPCR. Journal of Aquatic Animal Health, 31: 274–289.
Teffer AK, Hinch SG, Miller KM, Patterson DA, Farrell AP, Cooke SJ, et al. 2017. Capture severity, infectious disease processes and sex influence post-release mortality of sockeye salmon bycatch. Conservation Physiology, 5: cox017.
Thakur KK, Vanderstichel R, Li S, Laurin E, Tucker S, Neville C, et al. 2018. A comparison of infectious agents between hatchery-enhanced and wild out-migrating juvenile chinook salmon (Oncorhynchus tshawytscha) from Cowichan River, British Columbia. Facets, 3: 695–721.
Tierney KB, and Farrell AP. 2004. The relationships between fish health, metabolic rate, swimming performance and recovery in return-run sockeye salmon, Oncorhynchus nerka (Walbaum). Journal of Fish Diseases, 27: 663–671.
Tucker S, Li S, Kaukinen KH, Patterson DA, and Miller KM. 2018. Distinct seasonal infectious agent profiles in life-history variants of juvenile Fraser River Chinook salmon: an application of high-throughput genomic screening. PLoS ONE, 13: e0195472.
Vendramin N, Ruane NM, Rimstad E, Cuenca A, Sørensen J, Alencar ALF, et al. 2019. Presence and genetic variability of Piscine orthoreovirus genotype 1 (PRV-1) in wild salmonids in Northern Europe and North Atlantic Ocean. Journal of Fish Diseases, 42: 1107–1118.
Wessel Ø, Braaen S, Alarcon M, Haatveit H, Roos N, Markussen T, et al. 2017. Infection with purified Piscine orthoreovirus demonstrates a causal relationship with heart and skeletal muscle inflammation in Atlantic salmon. PLoS ONE, 12: e0183781.
White VC, Morado JF, Crosson LM, Vadopalas B, and Friedman CS. 2013. Development and validation of a quantitative PCR assay for Ichthyophonus spp. Diseases of Aquatic Organism, 104: 69–81.
Wiik-Nielsen CR, Ski PMR, Aunsmo A, and Løvoll M. 2012. Prevalence of viral RNA from piscine reovirus and piscine myocarditis virus in Atlantic salmon, Salmo salar L., broodfish and progeny. Journal of Fish Diseases, 35: 169–171.
Wiik-Nielsen J, Alarcón M, Fineid B, Rode M, and Haugland Ø. 2013. Genetic variation in Norwegian piscine myocarditis virus in Atlantic salmon, Salmo salar L. Journal of Fish Diseases, 36: 129–139.
Wiik-Nielsen J, Alarcón M, Jensen BB, Haugland Ø, and Mikalsen AB. 2016. Viral co-infections in farmed Atlantic salmon, Salmo salar L., displaying myocarditis. Journal of Fish Diseases, 39: 1495–1507.
Yu G, Lam TTY, Zhu H, and Guan Y. 2018. Two methods for mapping and visualizing associated data on phylogeny using GGTree. Molecular Biology and Evolution, 35: 3041–3043.

Supplementary materials

Supplementary Material 1 (PDF / 84 KB)
Supplementary Material 2 (DOCX / 17 KB)

Information & Authors

Information

Published In

cover image FACETS
FACETS
Volume 5Number 1January 2020
Pages: 234 - 263
Editor: Vance L. Trudeau

History

Received: 21 August 2019
Accepted: 28 January 2020
Version of record online: 23 April 2020

Data Availability Statement

All relevant data are within the paper and Supplementary Material.

Key Words

  1. Atlantic salmon
  2. bacteria
  3. virus
  4. infectious agent
  5. disease ecology
  6. qPCR

Sections

Subjects

Authors

Affiliations

Amy K. Teffer [email protected]
Department of Forest and Conservation Sciences, University of British Columbia, 2424 Main Mall, Vancouver, BC V6T 1Z4, Canada
Jonathan Carr
Atlantic Salmon Federation, Chamcook, NB E5B 3A9, Canada
Amy Tabata
Pacific Biological Station, Fisheries and Oceans Canada, Nanaimo, BC V9T 6N7, Canada
Angela Schulze
Pacific Biological Station, Fisheries and Oceans Canada, Nanaimo, BC V9T 6N7, Canada
Ian Bradbury
Salmonids Section, Fisheries and Oceans Canada, St. John’s, NF A1C 5X1, Canada
Denise Deschamps
Ministère des Forêts, de la Faune et des Parcs du Québec, Direction de l’expertise sur la faune aquatique, Quebec, QC G1S 4X4, Canada
Carole-Anne Gillis
Gespe’gewaq Mi’gmaq Resource Council, Listuguj, QC G0C 2R0, Canada
Eric B. Brunsdon
Atlantic Salmon Federation, Chamcook, NB E5B 3A9, Canada
Gideon Mordecai
Department of Medicine, University of British Columbia, Vancouver, BC V5Z 1M9, Canada
Kristina M. Miller
Pacific Biological Station, Fisheries and Oceans Canada, Nanaimo, BC V9T 6N7, Canada

Author Contributions

JC, EBB, and KMM conceived and designed the study.
JC, AT, AS, IB, DD, C-AG, and EBB performed the experiments/collected the data.
AKT, JC, AS, GM, and KMM analyzed and interpreted the data.
JC, IB, DD, C-AG, EBB, and KMM contributed resources.
AKT, JC, DD, C-AG, EBB, GM, and KMM drafted or revised the manuscript.

Competing Interests

The authors have declared that no competing interests exist.

Metrics & Citations

Metrics

Other Metrics

Citations

Cite As

Export Citations

If you have the appropriate software installed, you can download article citation data to the citation manager of your choice. Simply select your manager software from the list below and click Download.

Cited by

1. PRV-1b and PRV-3a infection is associated with the same clinical disease in coho salmon (Oncorhynchus kisutch) farmed in Chile: unraveling the pathogenesis of the orthoreoviral cardiomyopathy and hemolytic jaundice (OCHJ)
2. A novel high-throughput qPCR chip for solving co-infections in RAS farmed rainbow trout
3. Quantification of impedance and mechanical properties of Zeonor using scanning acoustic microscopy
4. Caliciviruses of fish
5. Amnoonviruses and non-influenza orthomyxoviruses of fish
6. Acoustic Velocity Estimation of Salmon Fish Scales Using Acoustic Microscope
7. Pathogens and Passengers: Roles for Crustacean Zooplankton Viruses in the Global Ocean
8. Genetic stock identification reveals greater use of an oceanic feeding ground around the Faroe Islands by multi-sea winter Atlantic salmon, with variation in use across reporting groups
9. Environmental DNA Methods for Ecological Monitoring and Biodiversity Assessment in Estuaries
10. Genetic stock identification reveals greater use of an oceanic feeding ground around the Faroe Islands by multi-sea winter Atlantic salmon
11. Understanding risks and consequences of pathogen infections on the physiological performance of outmigrating Chinook salmon
12. Aquaculture mediates global transmission of a viral pathogen to wild salmon
13. Wild salmonids are running the gauntlet of pathogens and climate as fish farms expand northwards
14. Discovery and surveillance of viruses from salmon in British Columbia using viral immune-response biomarkers, metatranscriptomics, and high-throughput RT-PCR
15. Cleaner fish in aquaculture: review on diseases and vaccination
16. Piscine orthoreovirus: Biology and distribution in farmed and wild fish

View Options

View options

PDF

View PDF

Figures

Tables

Media

Share Options

Share

Share the article link

Share on social media